ngsfilter : Assigns sequence records to the corresponding experiment/sample based on DNA tags and primers¶
To distinguish between sequences from different PCR products pooled in the same sequencing library, pairs of small DNA
sequences (call tags, see the oligoTag command and its associated paper for more informations on the design
of such tags) can be concatenated to the PCR primers.
ngsfilter takes as input sequence record files and a file describing the DNA tags and primers sequences used
for each PCR sample. ngsfilter allows to demultiplex sequence records file by identifying these DNA tags and
the primers.
ngsfilter requires a sample description file containing the description of the primers and tags associated
to each sample (specified by option -t). The sample description file is a text file where each line describes one
sample. Columns are separated by space or tab characters. Lines beginning with the ‘#’ character will be considered
as commentary lines and will simply be ignored by ngsfilter.
Here is an example of a sample description file:
#exp sample tags forward_primer reverse_primer extra_information
gh 01_11a cacgcagtc:cacgcatcg GGGCAATCCTGAGCCAA CCATTGAGTCTCTGCACCTATC F @ community=Festuca; bucket=1; extraction=1;
gh 01_12a cacgcatcg:cacgcagtc GGGCAATCCTGAGCCAA CCATTGAGTCTCTGCACCTATC F @ community=Festuca; bucket=1; extraction=2;
gh 01_21a cacgcgcat:cacgctact GGGCAATCCTGAGCCAA CCATTGAGTCTCTGCACCTATC F @ community=Festuca; bucket=2; extraction=1;
gh 01_22a cacgctact:cacgcgcat GGGCAATCCTGAGCCAA CCATTGAGTCTCTGCACCTATC F @ community=Festuca; bucket=2; extraction=2;
gh 02_11a cacgctgag:cacgtacga GGGCAATCCTGAGCCAA CCATTGAGTCTCTGCACCTATC F @ community=Festuca; bucket=1; extraction=1;
gh 02_12a cacgtacga:cacgctgag GGGCAATCCTGAGCCAA CCATTGAGTCTCTGCACCTATC F @ community=Festuca; bucket=1; extraction=2;
The results consist of sequence records, printed on the standard output, with their sequence trimmed of the primers and
tags and annotated with the corresponding experiment and sample (and possibly some extra informations). Sequences for
which the tags and primers have not been well identified, and which are thus unassigned to any sample, are stored in a
file if option -u is specified and tagged as erroneous sequences (error attribute) by ngsfilter.
ngsfilter specific options¶
-
-t,--tag-list¶ Used to specify the file containing the samples description (with tags, primers, sample names,...)
-
-u,--unidentified¶ Filename used to store the sequences unassigned to any sample
-
-e,--error¶ Used to specify the number of errors allowed for matching primers [default = 2]
Options to specify input format¶
Restrict the analysis to a sub-part of the input file¶
-
--skip<N>¶ The N first sequence records of the file are discarded from the analysis and not reported to the output file
-
--only<N>¶ Only the N next sequence records of the file are analyzed. The following sequences in the file are neither analyzed, neither reported to the output file. This option can be used conjointly with the –skip option.