The extended OBITools fasta and fastq format -------------------------------------------- .. _obitools-fasta: The *extended OBITools Fasta format* is a strict :doc:`fasta format file `. The file in *extended OBITools Fasta format* can be readed by all programs reading fasta files. Difference between standard and extended fasta is just the structure of the title line. For OBITools title line is divided in three parts : - Seqid : the sequence identifier - key=value; : a set of key/value keys - the sequence definition :: >my_sequence taxid=3456; direct=True; sample=A354; this is my pretty sequence ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT AACGACGTTGCAGTACGTTGCAGT Following these rules, the title line can be parsed : - The sequence identifier of this sequence is : *my_sequence* - Three keys are assigned to this sequence : - Key *taxid* with value *3456* - Key *direct* with value *True* - Key *sample* with value *A354* - The definition of this sequence is this is *my pretty sequence* Values can be any valid python expression. If a key value cannot be evaluated as a python expression, it is them assumed as a simple string. Following this rule, taxid value is considered as an integer value, direct value as a boolean and sample value is not a valid python expression so it is considered as a string value. Names reserved for attributes ............................. The following attribute names are created by some obitools programs and used by others. They have a special meaning. So we recommend not to use them with another semantic. Contents: .. toctree:: :maxdepth: 2 attributes/ali_dir attributes/ali_length attributes/avg_quality attributes/best_match attributes/best_identity attributes/class attributes/cluster attributes/complemented attributes/count attributes/cut attributes/direction attributes/distance attributes/error attributes/experiment attributes/family attributes/family_name attributes/forward_error attributes/forward_match attributes/forward_primer attributes/forward_score attributes/forward_tag attributes/forward_tm attributes/genus attributes/genus_name attributes/head_quality attributes/id_status attributes/merged_star attributes/merged attributes/mid_quality attributes/mode attributes/obiclean_cluster attributes/obiclean_count attributes/obiclean_head attributes/obiclean_headcount attributes/obiclean_internalcount attributes/obiclean_samplecount attributes/obiclean_singletoncount attributes/obiclean_status attributes/occurrence attributes/order attributes/order_name attributes/pairend_limit attributes/partial attributes/rank attributes/reverse_error attributes/reverse_match attributes/reverse_primer attributes/reverse_score attributes/reverse_tag attributes/reverse_tm attributes/sample attributes/scientific_name attributes/score attributes/score_norm attributes/select attributes/seq_ab_match attributes/seq_a_single attributes/seq_a_mismatch attributes/seq_a_deletion attributes/seq_a_insertion attributes/seq_b_single attributes/seq_b_mismatch attributes/seq_b_deletion attributes/seq_b_insertion attributes/seq_length attributes/seq_length_ori attributes/seq_rank attributes/sminL attributes/sminR attributes/species attributes/species_list attributes/species_name attributes/status attributes/strand attributes/tail_quality attributes/taxid